Oregano essential oil and Bacillus subtilis role in enhancing broiler’s growth, stress indicators, intestinal integrity, and gene expression under high stocking density | Scientific Reports

Scientific Reports volume 14, Article number: 25411 (2024) Cite this article

Metrics details

This study investigates the role of dietary Bacillus subtilis and oregano essential oil in mitigating the effects of high stocking density on growth performance, carcass traits, physiological stress indicators, gene expression, and intestinal integrity in broiler chickens. A total of, 1250 one-day-old Ross 308 male broiler chicks were randomly allocated to five experimental groups, where each group had five replicates of 50 chicks. Group 1 (control, LSD): 15 chicks/m2 fed a basal diet without feed additive, group 2 (HSD): 20 chicks/m2 fed a basal diet without feed additive, group 3 (BHSD): 20 chicks/m2 fed a basal diet supplemented with B. subtilis (500 mg/kg diet), group 4 (OHSD): 20 chicks/m2 fed a basal diet supplemented with oregano essential oil (300 mg/kg diet), group 5 (CHSD): 20 chicks/m2 fed a basal diet supplemented with oregano essential oil and B. subtilis. At 35 days of age, there was a noticeable improvement in the growth performance of broilers fed CHSD under high stocking density through the increase in body weight gain, dressing percentage, and crude protein digestibility with a decrease in feed conversion rate compared to other groups. Adding CHSD enhanced the state of oxidation and immunity through increasing superoxide dismutase, glutathione peroxidase, and the relative weight of bursa of Fabricius, while decreasing malondialdehyde, in addition to increasing plasma triiodothyronine levels. The microbial structure and morphometric parameters improved in the group that received the CHSD compared to the other groups, where villus height and Lactobacillus population increased, whereas Escherichia coli and Clostridium perfringens population decreased. Glucose transporter 2 (GLUT2), fatty acid transporter 1 (FABP1), and amino acid transferase 1 (CAT1) gene expression levels significantly increased when feeding on oregano essential oil with B. subtilis. In conclusion, combining oregano essential oil and B. subtilis supplements mitigated the effects of high stocking density by enhancing growth performance, antioxidative status, and intestinal integrity, in addition to modifying the genetic expression of genes related to nutrient absorption.

One of the new strategies used to keep pace with the increasing demand for poultry meat is the high stocking density of broiler chickens. In addition to attempting to reduce the poultry industry’s costs, poultry producers and companies have pushed to increase the storage density rate to reduce costs. However, some obstacles affect the spread of this strategy in developing countries, due to the weak technological capabilities of the broiler’s houses, in addition to the presence of some negative effects that include the bird’s exposure to some environmental pressures, slow growth rate, and deterioration of the welfare, immune system, and characteristics of the carcass1,2,3. Many previous studies have reported the possibility of using the high-density strategy under favorable environmental conditions (heat, humidity, and litter) and good husbandry management (ventilation and litter)4. In developing countries, it is difficult to provide the optimal environmental conditions to implement the high stocking density strategy due to weak capabilities in addition to environmental pressures such as heat stress (hot weather). This made nutritionists research using some feed additives that reduce the negative effects while the bird is exposed to stress to improve production performance, such as probiotics and plant products5,6.

Plant product supplements such as essential oils boost growth performance and feed utilization in the broiler industry7,8. Essential oils enhance broiler production by stimulating various digestive enzyme activities, increasing nutrient digestion9, reducing the number of intestinal pathogenic microbiota, and improving antioxidant status10 and immune response, in addition to preventing subclinical infections11,12. The most common essential oils used in broiler diets include turmeric, thyme, cinnamon, garlic, and oregano13. Oregano is an herb obtained by drying leaves and flowers of Origanum vulgar. Oregano essential oil has 2 master phenols: thymol and carvacrol, which constitute about 80—85% of essential oil. Using oregano essential oil in the broiler’s diet positively affected growth performance14. Supplemental oregano essential oil in the broiler diet exhibited a protective effect against Clostridium perfringens by reducing its content in the intestinal15.

Probiotics are beneficial bacteria that have positive impacts and that can adjust intestinal bacterial, and the gut environment of the host, as well as, enhance immune response, and resistance to microflora infection, and in turn, improve growth performance in broilers16,17. Bacteria B. subtilis have been widely used as commercialized probiotic products for feed poultry18,19. B. subtilis is one type of promising probiotic, due to the high stability of spores, which are resistant to harsh gastrointestinal conditions and high temperatures during feed processing and confer health benefits to the bird20. Previous studies indicated that B. subtilis had positive impacts on digestibility, intestinal microbes, gut morphology, and immune response17 and improved their growth performance21. Therefore, the current study hypothesized that using dietary oregano essential oil and B. subtilis may improve the performance, carcass traits, gut microflora, physiological stress indicators, and gene expression of broilers subjected to HSD. Therefore, the objective of this study was to evaluate the potential role of adding oregano essential oil and B. subtilis on performance, carcass traits, physiological stress indicators, nutrient absorption-related gene expression, and gut microflora and histological in broilers under high stocking density conditions.

The impact of supplementation of oregano essential oil with B. subtilis and stocking density on productive performance indexes is shown in Table 1. Body weight gain (BWG), the cumulative feed intake (CFI), and feed conversion rate (FCR) during the period from 0 to 21 days were not influenced (p < 0.05) by experimental feed additives and stocking density. While the experimental feed additives and stocking density significantly affected BWG and FCR, however, the CFI was not affected during the period from 0 to 35 days. BWG and FCR deteriorated in group HSD compared to the LSD group during the period from 0 to 35 days. Experimental additives improved the BWG and FCR in the BHSD, OHSD, and CHSD groups (p < 0.05) compared to the HSD group, during the overall period from 0 to 35 days. Despite this, the best growth performance (BWG and FCR) was in the group fed oregano essential oil with B. subtilis (CHSD, p < 0.05) compared with BHSD, OHSD, and HSD groups. Nevertheless, BWG and FCR were similar in the chickens that were fed LSD and CHSD. Regarding carcass characteristics, the dressing percentage deteriorated in the HSD chickens group (p < 0.05) compared to the LSD chickens group. However, the dressing percentage in the BHSD and CHSD chicken groups was improved than the HSD chicken group. In addition to the decreased abdominal fat content in the BHSD, and CHSD groups (p < 0.05) than in the OHSD, HSD, and LSD groups. However, liver weight was not affected in this study.

The impact of supplementation of oregano essential oil with B. subtilis and stocking density on digestive system performance, including nutrient digestibility (%) and digestive enzyme activity are shown in Table 2. Digestibility of nutrients such as dry matter and fat was not influenced (p < 0.05) by experimental additives or stocking density, except for crude protein, which increased in the CHSD group compared to other groups. Trypsin enzyme activity increased in CHSD and OHSD groups (p < 0.05) compared to LSD, HSD, and BHSD groups. However, lipase and amylase enzyme activity was not affected (p < 0.05) by the experimental feed additions and stocking density.

The impact of supplementation of oregano essential oil with B. subtilis and stocking density on physiological stress indicators, including antioxidative status and triiodothyronine (T3), are shown in Table 3. SOD levels increased (p < 0.05) in CHSD and BHSD groups compared with other groups. Furthermore, GPx levels increased in LSD and CHSD groups compared with other groups, while MDA levels decreased in OHSD and CHSD groups compared with other groups. Plasma triiodothyronine (T3) levels also increased in the BHSD and CHSD (p < 0.05) groups compared with other groups. The immune organs were not affected, including the spleen and thymus, by the experimental additives and the stocking density (Table 4), except for the relative weight of the bursa of Fabricius, which increased in in BHSD and CHSD groups (p < 0.05) compared with other groups.

The impact of supplementation of oregano essential oil with B. subtilis and stocking density on intestinal integrity, including microbial architecture and histomorphology, are shown in Table 4. The experimental additions led to significant changes in the microbial content through a noticeable decrease in the intestinal content of E. coli and C. perfringens in the CHSD and BHSD groups (p < 0.05) compared to the OHSD and HSD groups, whereas, the Lactobacillus count increased in the CHSD group compared with other groups. However, Salmonella counts were not influenced (p < 0.05) by the experimental additions or stocking density. Villus height increased in the CHSD and BHSD groups (p < 0.05) compared to the other groups. Furthermore, the VH/CD ratio was higher in the CHSD group than in the rest groups, however, the crypt depth was not influenced between the experimental treatments.

The impact of supplementation of oregano essential oil with B. subtilis and stocking density on gene expression, including GLUT2, FABP1, and CAT1, are shown in Fig. 1. In the HSD group, GLUT2, CAT1, and FABP1 gene expression significantly down-regulated (p < 0.05) than that in the LSD group. However, in the BHSD and CHSD groups, GLUT2, CAT1, and FABP1 gene expression significantly up-regulated (p < 0.05) than in the HSD group. Furthermore, the OHSD group had higher expression of FABP1 gene (p < 0.05) than the LSD group.

Effect of adding oregano essential oil and Bacillus subtilis on glucose transporter 2 (GLUT2), amino acid transferase 1 (CAT1), and fatty acid transporter 1 (FABP1) gene expression of broiler chickens under high stocking density. LSD; 15 chicks/m2 feeding a basal diet without feed additive, HSD; 20 chicks/m2 feeding a basal diet without feed additive, BHSD; 20 chicks/m2 feeding a basal diet with B. subtilis, OHSD; 20 chicks/m2 feeding a basal diet with oregano essential oil, CHSD; 20 chicks/m2 feeding a basal diet with oregano essential oil and B. subtilis. Data are presented as the mean values with their standard errors. Values with different superscript letters are significantly different (P < 0.05). All data are expressed as the mean ± SD. Beta-actin was used as a housekeeping gene.

Poultry industry suffers from many stress factors that harm production performance and costs, including rearing stress, such as high stocking density, which producers frame to reduce costs and provide the required protein needs. Therefore, this study investigated the potential positive effect of nutritional additives to mitigate the harmful effects of high stocking density on growth performance, carcass traits, indicators of physiological stress, intestinal integrity, and some gene expressions related to nutrient absorption of broilers.

Results of the current study display an impairment in growth performance with an increasing stocking density through a decrease in body weight and an increase in the feed conversion ratio. Consistent with our results, several studies have detected a significantly lower growth performance with increasing stocking density22,23. Similarly, Nasr et al.24 reported increasing stocking density had a decrease in body weight, resulting in a detrimental impact on growth performance, which supported the current results. In addition, our results display a noticeable amelioration in growth performance in the broiler fed combination of oregano essential oil and B. subtilis under conditions of high stocking density. Our results are supported by many studies, which reported that adding B. subtilis to broiler diets led to a noticeable improvement in growth performance19,25. Our findings are consistent with past studies that have shown that feeding oregano essential oils to broilers under environmental stress improves growth performance26,27. Likewise, Basmacioğlu et al.,28 and Zaazaa et al.,14 reported that adding oregano essential oil improved the performance of broiler chickens by higher body weight gain and the lowest feed conversion ratio. The noticeable improvement in the productive performance of chickens fed oregano essential oil and B. subtilis combination under high stocking density conditions may be due to promoting nutrient utilization, enhancing digestive and antioxidative enzymes, and immune response, in addition to reducing the number of pathogenic microorganisms and improving intestine morphology, as indicated by Jang et al.29; Alagawany et al.30; Elbaz et al.9. The results of our study are consistent with previous reports, which demonstrate the positive effect of adding oregano essential oil and B. subtilis on improving growth performance. Therefore, combining oregano essential oil with B. subtilis synergized in improving growth performance.

In agreement with the results of growth performance in the current study, there was an improvement in carcass specifications through an increase in the dressing percentage in the group fed a mixture of oregano essential oil with B. subtilis compared to the group that did not receive additives under high stocking density. However, there was a noticeable similarity in carcass characteristics between the group fed a mixture of oregano essential oil with B. subtilis and the group with low stocking density. Many studies have confirmed a close connection between enhanced nutrient digestibility and increased dressing percentage in broilers via significant increases in gut percentage and length of the intestine, in addition to modifying the microbial content31,32. Results by Jang et al.29 and Elbaz et al.9 reported that phytogenic (including essential oil) or probiotic feed additives improved the apparent intestinal digestibility of nutrients and promoted digestive enzyme activity, reflecting on increased dressing percentage.

Moreover, in this study, abdominal fat content decreased in chickens fed B. subtilis, whether alone or combined with oregano essential oil. These results agree with Elbaz et al.33, who reported adding probiotics to broiler chicken diets to reduce abdominal fat percentage relative to BW. Likewise, feeding broilers a diet containing essential oil led to decreased abdominal fat34. The decrease in abdominal fat could be related to the active chemicals in essential oils that are involved in lipid metabolism resulting in a reduced rate-limiting enzyme involved in cholesterol synthesis, 3 hydroxy-3‐methylglutaryl coenzyme A reductase, which affects cholesterol production and reduces abdominal fat35. Beneficial microbes (including B. subtilis) in the intestine play an important role in the metabolism of fats by reducing the production of the acetyl-CoA carboxylase enzyme, which has a catalytic impact in the synthesis of fatty acids, which lessens lipogenesis9. The decrease in abdominal fat has an economic benefit for the poultry industry, as the decrease in abdominal fat corresponds to an increase in the percentage of carcass yield, in addition to the fact that abdominal fat is one of the main wastes in slaughterhouses36. Abdominal fat lower suggests the beneficial influence of the experimental supplement on the distribution of fat in the carcass, which may contribute to the fatty acids between the muscles and thus improve carcass quality37. Subsequently, a combination of B. subtilis and oregano essential oil enhances the characteristics of the carcass, which includes increasing the dressing percentage and improving the distribution of the fat inside the carcass, which enhances the carcass quality.

Digestive system performance was investigated to clarify the effect of experimental additives, via nutrient utilization, and enzyme activity was evaluated. The current research showed a noticeable improvement in the digestibility of crude protein and increased endogenous excretion of trypsin enzyme in chickens fed CHSD, in line with findings from previous studies24,38. These results are consistent with some reports that feeding broiler chickens a diet containing probiotics enhanced nutrient digestion5. Some results of previous studies also showed that B. subtilis increased the metabolism rates of crude protein and utilization rate19. A study by Basmacioğlu et al.28 confirmed that adding oregano essential oil improved the digestibility of crude protein and increased chymotrypsin activity. In agreement with the findings, Lee et al.39 noted that thymol and cinnamaldehyde compounds increased digestive enzyme activities in broilers’ pancreas tissue and intestinal digesta at 21 d. Our results demonstrate the beneficial effect of adding a mixture of oregano essential oil and B. subtilis on enhancing nutrient digestion and secretion of endogenous enzymes in broilers, which mitigates the harms of high storage density.

In this study, experimental additives enhanced oxidative status and thyroid activity, in addition to boosting the immune response by increasing SOD, T3 levels, and the relative weight of the bursa of Fabricius and decreasing MDA levels compared to the HSD group. These results are consistent with some reports that essential oil or probiotic positively impact antioxidant status, including catalase, GPx, and SOD and prevent the formation of reactive oxygen species and fatty acid oxidation40,41,42. In other studies43,44, in which essential oil was added, including cinnamon, carvacrol, and thymol, enhancement in antioxidant activity was noted by decreased MDA levels and increased total SOD activity in the liver. Zhang et al.45 noted that adding B. subtilis enhanced the antioxidant capacity of broilers. Similarly, Abdel-Moneim et al.46 demonstrated that probiotics substituted for antibiotics resulted in increased serum triiodothyronine (T3) concentrations and enhanced immunity in broilers. Thyroid hormones play an important role in stimulating the synthesis of some enzymes, hormones, and structural proteins, and elevated thyroid hormone levels following probiotic administration enhance chicken metabolism 48. Adding a mixture of essential oil with B. subtilis to a broiler diet positively impacts growth performance through antioxidant properties and immunomodulatory effects.

The gut contributes to maintaining the bird’s performance and immunity through the digestion and absorption of nutrients, in addition to its role in immune functions via maintaining the gut barrier functions, the condition of the villus, and the microbial content. The villus height and depth crypt are the most critical measures of the intestine’s absorption ability47,48,49. Therefore, studying the intestinal microbial content and morphology was necessary to clarify the effect of experimental additives on intestinal health. In the current study, feeding on a mixture of oregano essential oil and B. subtilis resulted in enhancing the integrity of the intestine, as the villi length and the number of lactobacilli increased, in contrast, the number of E. coli and C. perfringens decreased. These results are consistent with many reports that adding essential oil or probiotics positively impacts gut status via an increase in beneficial microbes and a decrease in harmful microbes16,41. Similarly, numerous scientists have stated that adding essential oils to the diet can increase the length and depth of the villi in the small intestine, resulting in improved absorption of nutrients50,51. The enhanced histomorphological appearance of the small intestine’s mucosa, characterized by heightened villus height, could be attributed to the bioactive substances found in essential oils that protect villi from damage by enhancing antioxidant enzyme function52. In addition, some research indicated that B. subtilis has bacteriostatic action on common pathogens like as E. coli due to B. subtilis secretion of pathogen-suppressive some substances53. B. subtilis are aerobes that need large amounts of oxygen for growth and reproduction, which could suppress the growth of aerobes like E. coli, thus maintaining the balance of the intestinal microenvironments19. B. subtilis and oregano essential oil can maintain the balance of the gut microbes by maintaining intestinal beneficial bacteria, in addition to competing with pathogens for nutrients with increased absorption surface, thus enhancing the feed conversion ratio and growth.

To evaluate environmental stress impacts different parameters have been used, including blood metabolites, and changes in microbial content, in addition, recent developments have focused on analyzing gene expression to identify genes important in stress responses. Different defensive measures are stimulated to protect tissue cells from stress, such as activating stress response genes, thus, gene regulation during stress is a potential indicator of stress severity. Exposure of the bird to stress impairs the absorption of nutrients by modulating the gene expression responsible for nutrient transport, for example, genes of the GLUT2, FABP1, and CAT1. GLUT2 gene, which is responsible for the transfer of fructose and glucose into portal blood capillaries in broiler intestines 55. In addition, decreased intestinal expression of the FABP1 in stressed broilers, which is involved in fatty acid uptake and transport, was observed55. The FABP1 gene’s function is to uptake long-chain fatty acids into enterocytes, which are primarily expressed in the intestinal epithelium. Additionally, stressed birds were found to change the expression of the CAT156. Our results showed a decrease in FABP1 and CAT1 gene expression in the HSD group, as a result of the bird being exposed to high stocking density (environmental stress). The current study’s findings align with previous research by Habashy et al.55 which showed that heat stress lowers FABP1 expression in the gut of broilers. Furthermore, the expression of the FABP1, GLUT2, and CAT1 genes increased in the broiler fed a diet that included oregano essential oil with B. subtilis under HSD compared with other groups. Adding probiotic strains to rabbit’s diet has been previously shown to enhance nutrient absorption57. Additionally, the expression of protein and glucose transporters genes showed upregulation in broilers feeding on probiotics58. Some study data indicated that FABP-2, SGLT-1, GLUT2, and CAT-1 gene expression levels were significantly increased (p < 0.05) in rabbits on a diet included with probiotics54. Thus, adding a mixture of oregano essential oil and B. subtilis regulates the gene expression of cells specialized in nutrient absorption, which enhances the utilization of nutrients and results in improved growth performance under high stocking density.

Our results demonstrate the harmful effect of high stocking density on productive performance, immune and antioxidative status, and intestinal integrity, in addition, the gene expression of nutrition absorption-related genes in the intestine decreased. The synergistic influence of the mixture of oregano essential oil and B. subtilis stimulates the digestion and absorption of nutrients; in addition, it enhances the immune response and oxidative status, thus improving growth performance in broilers under high stocking density. Oregano essential oil with B. subtilis mixture enhanced intestinal integrity by increasing beneficial microbes and villus length, in addition to modifying the genetic expression of genes related to nutrient absorption. Therefore, we recommend using it as a nutritional additive to mitigate the effects of high stocking density stress.

In the current study, 1250 one-day-old male broiler chicks (ROSS 308) were randomly divided into five experimental groups of 250 chicks each, and each group contained 5 replicates. The experimental groups were as follows; group 1 (control, LSD): 15 birds/m2 feeding a basal diet without feed additive, group 2 (HSD): 20 birds/m2 feeding a basal diet without feed additive, group 3 (BHSD): 20 birds/m2 feeding a basal diet supplemented with B. subtilis (500 mg/kg diet), group 4 (OHSD): 20 birds/m2 feeding a basal diet supplemented with oregano essential oil (300 mg/kg diet), group 5 (CHSD): 20 birds/m2 feeding a basal diet supplemented with oregano essential oil with B. subtilis. The diets were formulated to meet the needs of chicks as recommended in NRC59 and the diets were mixed in two batches (the starters and the finishers, as given in Table 5) and stored in bags at room temperature till starting the experiment. The broiler house temperature was closely monitored, starting at 32.5 C on two days and decreasing by 1 C every 3 days till 22 C end of the experiment. The chicks were exposed to 24 h of lighting for the first 1 week and then 2 h of darkness and 22 h of lighting until the end of the experiment, with an average light intensity of 20 lx. Chicks had access to water and feed around the clock. Oregano essential oil was provided by ELHAWAG Company (Giza, Egypt). B. subtilis strains (1.5 × 105 CFU/g feed) were obtained from the Department of Microbiology, Faculty of Agriculture, Ain Shams University, Egypt.

The initial average body weight was 41.2 ± 3 g and the average body weight of broiler chicks from each group was recorded. The average weight and feed intake were recorded weekly. The performance indexes were evaluated by calculating the body weight gain (BWG), the cumulative feed intake (CFI), the feed conversion rate (FCR, as CFI (g) per mean BW (g) for each replicate of the experimental groups), and survivability rates (%). Carcass traits were calculated based on relative live body weight, including dressing percentage, abdominal fat, and liver, in addition to an index of the chick’s immune situation including the spleen, thymus, and bursa of Fabricius.

The performance of the digestive system including nutrient digestibility, and digestive enzymatic activity was evaluated, by ten broilers from each group were collected at the age of 35 days and placed individually in digestion cages to begin the digestion experiment. Excreta were collected every eight hours for 3 days. At the end of the experiment, the excreta was dried and stored, then the feed was collected to measure nutrient digestibility (crude protein (CP), dry matter (DM]), and ether extract (EE)) according to AOAC60. During slaughter at 35 days, samples of cecal contents of about 2 g (10 birds/ group) were collected and placed in a neutral saline solution for preservation till analysis. The supernatant part after the solution was separated through centrifugation (1792 g for 15 min) to estimate digestive enzyme activity, including trypsin61, amylase62, and lipase63.

Before slaughter (35 days), ten blood samples were taken from each group from the jugular vein in heparinized tubes to obtain plasma and then centrifuged (3000×g for 15 min). Oxidation status indications in plasma were examined, including glutathione peroxidase (GPx), superoxide dismutase (SOD), and malondialdehyde (MDA), by using commercial kits (Spinreact Co. Girona, Spain). Plasma triiodothyronine (T3) hormone level was estimated by radioimmunoassay with a kit produced by the Institute of Isotopes Co., Ltd. (Budapest, Hungary).

Intestinal integrity including intestinal microbial architecture and histomorphological were evaluated. During slaughter, about 2 g of caecal contents were collected to determine the intestinal microbiota diversity. Samples were put into sterilized tubes and diluted with sterilized water to 1:10, then plated on agar plates using a glass rod, and then incubated for 48 h. Eosin methylene blue agar medium, Salmonella-Shigella agar medium, Shahidi Ferguson Perfringens (SFP) agar, and MacConkey agar medium were used for culturing Escherichia coli (37◦C), Salmonella (37◦C), Clostridium perfringens (37◦C), and Lactobacillus (30◦C), respectively. Results microbial count were evaluated as log10 colony-forming units per gram of cecal digesta. Ileal samples (~ 3 cm) were collected during slaughter to measure histomorphological. The samples were placed in 10% formalin saline solution till analyzed. Ileal slides (3–4 μm thickness) were cut using a rotary microtome, then checked by optical microscope to detect the histomorphological changes (villus height (VH) and crypt depth (CD)), as described by Elbaz et al. 5.

Some genes associated with nutrient absorption were selected, including glucose transporter 2 (GLUT2), fatty acid transporter 1 (FABP1), and amino acid transferase I (CAT1) with beta-actin (β-actin). According to the manufacturer’s instructions, total RNA was isolated from the ileum mucosa (two birds/ replicates) using the Trans-Zol reagent (Beijing, China). Using the Revert Aid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Vilnius, Lithuania) the cDNA was synthesized from total RNA, as directed by the manufacturer’s instructions. Primer sequences for the genes selected for the current study were synthesized by Invitrogen (ThermoFisher Scientific, Vilnius, Lithuania). The forward and reverse primers for FABP1 were ACTGGCTCCAAAGTAATGACCAATG and TGTCTCCGTTGAGTTCGGTCAC (Accession number NM_204192.4); for CAT1: CATCAACATCCTCGTCATC and CTCCATCCCAACCTACATAC (Accession number EU360441.1); for GLUT2: AGAGGAAACTGTGACCCGATGA and AACGAAGAGGAAGATGGCGA (Accession number Z22932.1); for βeta-actin: CCACCGCAAATGCTTCTAAAC and AAGACTGCTGCTGACACCTTC (Accession number NM 205518.2), respectively. After the forty cycles, a melting-curve analysis confirmed that a gene product was amplified. After the amplification procedure, the PCRs were carried out in a real-time thermal cycler machine (Rotor-Gene Q, QIAGEN, Hilden, Germany). Amplification curves and the RT-PCR data were analyzed using Rotor-Gene Q Series Software automatically PCR data obtained. In addition, the relative gene expression in samples was determined by comparing the CT value of each sample to that of the positive control according to Yuan et al.64.

The effects of the experimental supplemental on the performance, physiological stress indicators, microbial architecture, histomorphology, and gene expression were assessed using an ANOVA as a completely randomized design (GLM procedure in SAS Statistical Analysis Software, version 9.165), . Differences among means in the presence of statistical differences were assessed (p < 0.05) using Duncan’s multiple-range test. All data are expressed as the mean ± SD.

All data generated or analyzed during this study are included in this published article.

15 birds/m2 feeding a basal diet without feed additive

20 birds/m2 feeding a basal diet without feed additive

20 birds/m2 feeding a basal diet supplemented with B. subtilis

20 birds/m2 feeding a basal diet supplemented with oregano essential oil

20 birds/m2 feeding a basal diet supplemented with oregano essential oil with B. subtilis

Glutathione peroxidase

Superoxide dismutase

Malondialdehyde

Triiodothyronine

Glucose transporter 2

Fatty acid transporter 1

Amino acid transferase 1

Crude protein

Dry matter

Ether extract

Body weight gain

Cumulative feed intake

Feed conversion rate

Bacillus subtilis

Ebeid, T. A., Fathi, M. M., Al-Homidan, I., Ibrahim, Z. H. & Al- Sagan, A. A. Effect of dietary probiotics and stocking density on carcass traits, meat quality, microbial populations and ileal histomorphology in broilers under hot-climate conditions. Anim. Prod. Sci. 59, 1711–1719. https://doi.org/10.1071/AN18353 (2019).

Article Google Scholar

Cengiz, Ö. et al. Effect of dietary probiotic and high density lipoprotein on the performance, carcass yield, gut microflora, and stress indicators of broilers. Poult. Sci. 94, 2395–2403. https://doi.org/10.3382/ps/pev (2015).

Article CAS PubMed Google Scholar

Jobe, M. C., Ncobela, C. N., Kunene, N. W. & Opoku, A. R. Effects of Cassia abbreviata extract and stocking density on growth performance, oxidative stress and liver function of indigenous chickens. Trop. Anim. Health Prod. 51, 2567–2574. https://doi.org/10.1007/s11250-019-01979-y (2019).

Article PubMed PubMed Central Google Scholar

Sugiharto, S. Dietary strategies to alleviate high-stocking-density-induced stress in broiler chickens–a comprehensive review. Archives Anim. Breed. 65 (1), 21–36. https://doi.org/10.5194/aab-65-21-2022 (2022).

Article Google Scholar

Elbaz, A. M., El-Sheikh, S. E. & Abdel–Maksoud, A. Growth performance, nutrient digestibility, antioxidant state, ileal histomorphometry, and cecal ecology of broilers fed on fermented canola meal with and without exogenous enzymes. Trop. Anim. Health Prod. 55 (1), 46. https://doi.org/10.1007/s11250-023-03476-9 (2023).

Article PubMed PubMed Central Google Scholar

Abdel-Moneim, A. M. E. et al. Efficacy of supplementing Aspergillus awamori in enhancing growth performance, gut microbiota, digestibility, immunity, and antioxidant activity of heat-stressed broiler chickens fed diets containing olive pulp. BMC Vet. Res. 20 (1), 205. https://doi.org/10.1186/s12917-024-04050-7 (2024).

Article CAS PubMed PubMed Central Google Scholar

Li, H. L., Zhao, P. Y., Lei, Y. & Hossain, M. M. Kim. Phytoncide, phytogenic feed additive as an alternative to conventional antibiotics, improved growth performance and decreased excreta gas emission without adverse effect on meat quality in broiler chickens. Livest. Sci. 181, 1–6. https://doi.org/10.1016/j.livsci.2015.10.001 (2015).

Article ADS Google Scholar

Namdeo, S. et al. Essential oils: a potential substitute to antibiotics growth promoter in broiler diet. J. Entomol. Zool. Stud. 8, 1643–1649 (2020). www.entomoljournal.com.

Google Scholar

Elbaz, A. M. et al. Effects of garlic and lemon essential oils on performance, digestibility, plasma metabolite, and intestinal health in broilers under environmental heat stress. BMC Vet. Res. 18 (1), 1–12. https://doi.org/10.1186/s12917-022-03530-y (2022).

Article CAS Google Scholar

Elbaz, A. M. et al. Effectiveness of probiotics and clove essential oils in improving growth performance, immuno-antioxidant status, ileum morphometric, and microbial community structure for heat-stressed broilers. Sci. Rep. 13 (1), 18846. https://doi.org/10.1038/s41598-023-45868-9 (2023).

Article ADS CAS PubMed Google Scholar

Bakkali, F., Averbeck, S., Averbeck, D. & Idaomar, M. Biological effects of essential oils. A review. Food Chem. Toxicol. 46, 446–475. https://doi.org/10.1016/j.fct.2007.09.106 (2008).

Article CAS PubMed Google Scholar

Abou-Kassem, D. E. et al. Influences of dietary herbal blend and feed restriction on growth, carcass characteristics and gut microbiota of growing rabbits. Ital. J. Anim. Sci. 20, 896–910. https://doi.org/10.1080/1828051X.2021.1926348 (2021).

Article CAS Google Scholar

Abd El-Hack, M. E. et al. Essential oils and their nanoemulsions as green alternatives to antibiotics in poultry nutrition: a comprehensive review. Poult. Sci. 101 (2), 101584. https://doi.org/10.1016/j.psj.2021.101584 (2022).

Article CAS PubMed Google Scholar

Zaazaa, A. et al. The impact of thyme and oregano essential oils dietary supplementation on broiler health, growth performance, and prevalence of growth-related breast muscle abnormalities. Animals. 12 (21), 3065. https://doi.org/10.3390/ani12213065 (2022).

Article PubMed Google Scholar

Jin, X., Huang, G., Luo, Z., Hu, Y. & Liu, D. Oregano (Origanum vulgare L.) essential oil feed supplement protected broilers chickens against Clostridium perfringens. Induc. Necrotic Enteritis Agric. 12, 18. https://doi.org/10.3390/agriculture12010018 (2022).

Article CAS Google Scholar

Elbaz, A. Effect of Linseed Oil and Fermented Pomegranate Peel supplementation on the growth performance, Digestive function, and muscle fatty acid deposition of heat-stress broiler chickens. J. Adv. Veterinary Res. 13 (9), 1881–1888 (2023). https://www.advetresearch.com/index.php/AVR/article/view/1688

Google Scholar

Ciurescu, G., Dumitru, M., Gheorghe, A., Untea, A. E. & Drăghici, R. Effect of Bacillus subtilis on growth performance, bone mineralization, and bacterial population of broilers fed with different protein sources. Poult. Sci. 99 (11), 5960–5971. https://doi.org/10.1016/j.psj.2020.08.075 (2020).

Article CAS PubMed Google Scholar

Zhang, Y. R., Xiong, H. R. & Guo, X. H. Enhanced viability of Lactobacillus reuteri for probiotics production in mixed solid-state fermentation in the presence of Bacillus subtilis. Folia Microbiol. 59, 31–36. https://doi.org/10.1007/s12223-013-0264-4 (2013).

Article ADS CAS Google Scholar

Gao, Z. et al. Study of Bacillus subtilis on growth performance, nutrition metabolism and intestinal microflora of 1 to 42 d broiler chickens. Anim. Nutr. 3 (2), 109–113. https://doi.org/10.1016/j.aninu.2017.02.002 (2017).

Article PubMed Google Scholar

Su, Y., Liu, C., Fang, H. & Zhang, D. Bacillus subtilis: a universal cell factory for industry, agriculture, biomaterials and medicine. Microb. Cell. Fact. 19, 1–12. https://doi.org/10.1186/s12934-020-01436-8 (2020).

Article Google Scholar

Lee, K. W., Lillehoj, H. S., Jang, S. I. & Lee, S. H. Effects of salinomycin and Bacillus subtilis on growth performance and immune responses in broiler chickens. Res. Vet. Sci. 97 (2), 304–308. https://doi.org/10.1016/j.rvsc.2014.07.021 (2014).

Article CAS PubMed Google Scholar

Simitzis, P. E. et al. Impact of stocking density on broiler growth performance, meat characteristics, behavioural components and indicators of physiological and oxidative stress. Br. Poult. Sci. 53 (6), 721–730. https://doi.org/10.1080/00071668.2012.745930 (2012).

Article CAS PubMed Google Scholar

Chegini, S., Kiani, A. & Rokni, H. Alleviation of thermal and overcrowding stress in finishing broilers by dietary propolis supplementation. Italian J. Anim. Sci. 17 (2), 377–385. https://doi.org/10.1080/1828051X.2017.1360753 (2018).

Article CAS Google Scholar

Nasr, M. A., Alkhedaide, A. Q., Ramadan, A. A., Abd-El Salam, E. H. & Hussein, M. A. Potential impact of stocking density on growth, carcass traits, indicators of biochemical and oxidative stress and meat quality of different broiler breeds. Poult. Sci. 100 (11), 101442. https://doi.org/10.1016/j.psj.2021.101442 (2021).

Article CAS PubMed Google Scholar

Zhang, S. C., Gao, Z. H. & He, H. Prelimiminary observation of the effect of endophytic marine bacterium from mangrove on growth performance and immunologic function of yellow feather broilers. J. Henan Agri Sci. 43 (2), 119e22 (2014). http://www.hnagri.org.cn/hnnykx.htm

Google Scholar

Alagawany, M. et al. The usefulness of oregano and its derivatives in poultry nutrition. World’s Poult. Sci. J. 74, 463–474. https://doi.org/10.1017/S0043933918000454 (2018).

Article Google Scholar

Tekce, E. & Gül, M. Effects of Origanum syriacum essential oil added in different levels to the diet of broilers under heat stress on performance and intestinal histology. Eur. Poult. Sci., 80. https://doi.org/10.1399/eps.2016.157 (2016).

Basmacioğlu Malayoğlu, H., Baysal, Ş., Misirlioğlu, Z., Polat, M. & Turan, N. Effects of oregano essential oil with or without feed enzymes on growth performance, digestive enzyme, nutrient digestibility, lipid metabolism and immune response of broilers fed on wheat–soybean meal diets. Br. Poult. Sci. 51 (1), 67–80. https://doi.org/10.1080/00071660903573702 (2010).

Article CAS PubMed Google Scholar

Jang, I. S., Ko, Y. H., Kang, S. Y. & Lee, C. Y. Effect of a commercial essential oil on growth performance, digestive enzyme activity and intestinal microflora population in broiler chickens. Anim. Feed Sci. Technol. 134, 304–315. https://doi.org/10.1016/j.anifeedsci.2006.06.009 (2007).

Article CAS Google Scholar

Alagawany, M. et al. Use of lemongrass essential oil as a feed additive in quail’s nutrition: its effect on growth, carcass, blood biochemistry, antioxidant and immunological indices, digestive enzymes and intestinal microbiota. Poult. Sci. 100 (6), 101172. https://doi.org/10.1016/j.psj.2021.101172 (2021).

Article CAS PubMed PubMed Central Google Scholar

Attia, Y. A., Al-Khalaifah, H., El-Hamid, A., Al-Harthi, H. S., El-Shafey, A. A. & M.A. & Growth performance, digestibility, intestinal morphology, carcass traits and meat quality of broilers fed marginal nutrients deficiency-diet supplemented with different levels of active yeast. Livest. Sci. 233, 103945. https://doi.org/10.1016/j.livsci.2020.103945 (2020).

Article Google Scholar

Elbaz, A. M., Zaki, E. F., Salama, A. A., Badri, F. B. & Thabet, H. A. Assessing different oil sources efficacy in reducing environmental heat-stress effects via improving performance, digestive enzymes, antioxidant status, and meat quality. Scientific Reports, 13(1), p.20179. DOI: (2023). https://doi.org/10.1038/s41598-023-47356-6

Elbaz, A. M., Ibrahim, N. S., Shehata, A. M., Mohamed, N. G. & Abdel-Moneim, A. M. E. Impact of multi-strain probiotic, citric acid, garlic powder or their combinations on performance, ileal histomorphometry, microbial enumeration and humoral immunity of broiler chickens. Trop. Anim. Health Prod. 53, 1–10. https://doi.org/10.1007/s11250-021-02554-0 (2021).

Article Google Scholar

Irawan, A., Hidayat, C., Jayanegara, A. & Ratriyanto, A. Essential oils as growth-promoting additives on performance, nutrient digestibility, cecal microbes, and serum metabolites of broiler chickens: a meta-analysis. Anim. Bioscience. 34 (9), 1499. https://doi.org/10.5713/ab.20.0668 (2021).

Article CAS Google Scholar

Zhang, G. F. et al. Effects of ginger root (Zingiber officinale) processed to different particle sizes on growth performance, antioxidant status, and serum metabolites of broiler chickens. Poult. Sci. 88 (10), 2159–2166. https://doi.org/10.3382/ps.2009-00165 (2009).

Article CAS PubMed Google Scholar

Axling, U. et al. Green tea powder and Lactobacillus plantarum affect gut microbiota, lipid metabolism and inflammation in highfat fed C57BL/6J mice. Nutr. Metab. 9, 1–18. https://doi.org/10.1186/1743-7075-9-105 (2012).

Article ADS CAS Google Scholar

Wood, J. D. et al. Fat deposition, fatty acid composition and meat quality: a review. Meat Sci. 78 (4), 343–358. https://doi.org/10.1016/j.meatsci.2007.07.019 (2008).

Article CAS PubMed Google Scholar

Gao, Z. et al. Endophytic bacterium from mangrove affects performance, nutrient apparent metabolic rates and serum biochemical indices in yellow-feathered broilers. Chin. J. Anim. Nutr. 24 (6), 1132–1136 (2012). http://www.chinajan.com/10602.shtml

CAS Google Scholar

Lee, K. W. et al. Effects of dietary essential oil components on growth performance, digestive enzymes and lipid metabolism in female broiler chickens. Br. Poult. Sci. 44 (3), 450–457. https://doi.org/10.1080/0007166031000085508 (2003).

Article CAS PubMed Google Scholar

Abd El-Hack, M. E. et al. Alternatives to antibiotics for organic poultry production: types, modes of action and impacts on bird’s health and production. Poult. Sci. 101, 101696. https://doi.org/10.1016/j.psj.2022.101696 (2022).

Article CAS PubMed Google Scholar

Abdel-Moneim, A. M. E., Shehata, A. M., Mohamed, N. G., Elbaz, A. M. & Ibrahim, N. S. Synergistic effect of Spirulina platensis and selenium nanoparticles on growth performance, serum metabolites, immune responses, and antioxidant capacity of heat-stressed broiler chickens. Biol. Trace Elem. Res. 1–12. https://doi.org/10.1007/s12011-021-02662-w (2022).

Miguel, M. G. Antioxidant and anti-inflammatory activities of essential oils: a short review. Molecules. 15, 9252–9587. https://doi.org/10.3390/molecules15129252 (2010).

Article CAS PubMed Google Scholar

Chowdhury, S. et al. Different essential oils in diets of broiler chickens: 2. Gut microbes and morphology, immune response, and some blood profile and antioxidant enzymes. Anim. Feed Sci. Technol. 236, 39–47. https://doi.org/10.1016/j.anifeedsci.2017.12.003 (2018).

Article CAS Google Scholar

Habibi, R., Sadeghi, G. H. & Karimi, A. Effect of different concentrations of ginger root powder and its essential oil on growth performance, serum metabolites and antioxidant status in broiler chicks under heat stress. Br. Poult. Sci. 55, 228–237. https://doi.org/10.1080/00071668.2014.887830 (2014).

Article CAS PubMed Google Scholar

Zhang, Y. et al. Bacillus subtilis improves antioxidant capacity and optimizes inflammatory state in broilers. Anim. Bioscience. 37 (6). https://doi.org/10.5713/ab.23.0320 (2024).

Abdel-Moneim, A. M. E., Elbaz, A. M., Khidr, R. E. S. & Badri, F. B. Effect of in ovo inoculation of Bifidobacterium spp. on growth performance, thyroid activity, ileum histomorphometry, and microbial enumeration of broilers. Probiotics Antimicrob. Proteins. 12, 873–882. https://doi.org/10.1007/s12602-019-09613-x (2020).

Article CAS PubMed Google Scholar

Aluwong, T., Hassan, F., Dzenda, T., Kawu, M. & Ayo, J. Effect of different levels of supplemental yeast on body weight, thyroid hormone metabolism and lipid profile of broiler chickens. J. Vet. Med. Sci. 75 (3), 291–298. https://doi.org/10.1292/jvms.12-0368 (2013).

Article CAS PubMed Google Scholar

Wickramasuriya, S. S. et al. Role of physiology, immunity, microbiota, and infectious diseases in the gut health of poultry. Vaccines. 10 (2), 172. https://doi.org/10.3390/vaccines10020172 (2022).

Article CAS PubMed PubMed Central Google Scholar

Abd El-Hamid, M. I. et al. Modulatory impacts of multi-strain probiotics on rabbits’ growth, nutrient transporters, tight junctions and immune system to fight against Listeria monocytogenes infection. Animals, 12(16), p. doi: (2082). https://doi.org/10.3390/ani12162082 (2022).

Samanta, S., Haldar, S. & Ghosh, T. K. Comparative efficacy of an organic acid blend and bacitracin methylene disalicylate as growth promoters in broiler chickens: effects on performance, gut histology, and small intestinal milieu. Veterinary Med. Int. 1-8https://doi.org/10.4061/2010/645150 (2010).

Awaad, M., Elmenawey, M. & Ahmed, K. A. Effect of a specific combination of carvacrol, cinnamaldehyde, and Capsicum oleoresin on the growth performance, carcass quality and gut integrity of broiler chickens. Vet. World. 7, 284–290. https://doi.org/10.14202/vetworld.2014.284-290 (2014).

Article CAS Google Scholar

Hamedi, S., Shomali, T. & Ghaderi, H. Effect of dietary inclusion of Mentha Piperita L. on histological and histomorphometrical parameters of the small intestine in broiler chickens. Org. Agric. 7, 105–110. https://doi.org/10.1007/s13165-016-0153-7 (2017).

Article Google Scholar

Ushakova, N. A. et al. Effect of Bacillus subtilis on the rumen microbial community and its components exhibiting high correlation coefficients with the host nutrition, growth, and development. Microbiology. 82, 475–481. https://doi.org/10.1134/S0026261713040127 (2013).

Article CAS Google Scholar

Mueckler, M. & Thorens, B. The SLC2 (GLUT) family of membrane transporters. Mol. Aspects Med. 34 (2–3), 121–138. https://doi.org/10.1016/j.mam.2012.07.001 (2013).

Article CAS PubMed Google Scholar

Habashy, W. S. et al. Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens. Int. J. Biometeorol. 61, 2111–2118. https://doi.org/10.1007/s00484-017-1414-1 (2017).

Article ADS PubMed Google Scholar

Abdelli, N. et al. Effects of cyclic chronic heat stress on the expression of nutrient transporters in the jejunum of modern broilers and their ancestor wild jungle fowl. Front. Physiol. 12, 733134. https://doi.org/10.3389/fphys.2021.733134 (2021).

Article PubMed Google Scholar

Chandra, S., Mahender, M., Prakash, M. G., Raghunandan, T. & Reddy, K. K. Productive performance of broiler rabbits fed diets supplemented with probiotic and enzymes under two systems of housing. Indian J. Anim. Res. 48, 355–361. https://doi.org/10.5958/0976-0555.2014.00455.5 (2014).

Article Google Scholar

Biswas, A., Dev, K., Tyagi, P. K. & Mandal, A. The effect of multi-strain probiotics as feed additives on performance, immunity, expression of nutrient transporter genes and gut morphometry in broiler chickens. Anim. Biosci. 35, 64–74. https://doi.org/10.5713/ab.20.0749 (2022).

Article CAS PubMed Google Scholar

NRC. National Research Council. Nutrient Requirements of Poultry 9th ed. Composition of poultry feedstuffs. National Academy Press, Washington, DC, USA. p.pp. 61–75. (1994).

AOAC. Association of official analytical chemists. Official Methods Anal. 73, 12 (1990).

Sklan, D., Dubrov, D., Eisner, U. & Hurwitz, S. 51Cr-EDTA, 91Y and 141Ce as nonabsorbed reference substances in the gastrointestinal tract of the chicken. J. Nutr. 105, 1549–1552. https://doi.org/10.1093/jn/105.12.1549 (1975).

Article CAS PubMed Google Scholar

Pinchasov, Y., Nir, I. & Nitsan, Z. Metabolic and anatomical adaptations of heavy-bodied chicks to intermitent feeding. 2. Pancreatic digestive enzymes. Br. Poult. Sci. 31, 769–777. https://doi.org/10.1080/00071669008417307 (1990).

Article CAS PubMed Google Scholar

Sklan, D. & Halevy, O. Digestion and absorption of protein along ovine gastrointestinal tract. J. Dairy Sci. 68 (7), 1676–1681 (1985).

Article CAS PubMed Google Scholar

Yuan, J. S., Reed, A., Chen, F. & Stewart, C. N. Statistical analysis of real-time PCR data. BMC Bioinform. 7, 1–12. https://doi.org/10.1186/1471-2105-7-85 (2006).

Article CAS Google Scholar

SAS & Institute SAS R User’s Guide for Personal Computer (SAS Institute Inc, 2004).

Download references

The authors acknowledge their respective universities and institutes for their cooperation.

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). This work was financially supported by the Systel Telecom Company, Egypt.

Nutrition Department, Desert Research Center, Mataria, Cairo, Egypt

Ahmed M. Elbaz

Genetics Department, Faculty of Agriculture, Ain Shams University, Cairo, Egypt

Neima K. El-Sonousy

Poultry Nutrition Department, Animal Production Research Institute, Agricultural Research Center, Ministry Of Agriculture, Giza, Egypt

A. Sabry Arafa

Animal Production Department, Agricultural and Biology Research Institute, National Research Centre, Cairo, Egypt

M. G. Sallam

Department of Development of Animal Wealth, Faculty of Veterinary Medicine, Mansoura University, Mansoura, Egypt

Ahmed Ateya

Poultry Production Department, Faculty of Agriculture, Ain Shams University, Cairo, Egypt

AbdelRahman Y. Abdelhady

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

Conceptualization: A.M.E., A.Y.A.; Methodology: A.M.E., M.G. S., and A.A.; Formal analysis and investigation: N.K.S., A.Y.A., A.S.A.; Writing - original draft preparation: A.M.E.; Writing - review and editing: A.M.E., M.G. S., A.Y.A., N.K.S., and A.A.; Resources: A.Y.A., A.S.A.; Supervision: A.M.E., A.Y.A, and M.A.S. All authors read and approved the final manuscript.

Correspondence to Ahmed M. Elbaz.

This study was conducted in accordance with the Local Experimental Animals Care and Welfare Committee and approved by the Institutional Ethics Committee affiliated with the Faculty of Agriculture, Ain Shams University. All protocols were carried out in accordance with the Universal Directive on the Protection of Animals Used for Scientific Purposes. All protocols follow the ARRIVE guidelines for reporting animal research (https://arriveguidelines.org).

Not applicable.

The authors declare that they have no conflict of interest.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

Elbaz, A.M., El-Sonousy, N.K., Arafa, A.S. et al. Oregano essential oil and Bacillus subtilis role in enhancing broiler’s growth, stress indicators, intestinal integrity, and gene expression under high stocking density. Sci Rep 14, 25411 (2024). https://doi.org/10.1038/s41598-024-75533-8

Download citation

Received: 29 May 2024

Accepted: 07 October 2024

Published: 25 October 2024

DOI: https://doi.org/10.1038/s41598-024-75533-8

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative